View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16431_high_11 (Length: 342)

Name: NF16431_high_11
Description: NF16431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16431_high_11
NF16431_high_11
[»] chr1 (1 HSPs)
chr1 (74-110)||(46449905-46449941)


Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 74 - 110
Target Start/End: Complemental strand, 46449941 - 46449905
Alignment:
Q  74 attaattgtaactagctagctgcatactagtattata 110  Q
    |||||||||||||||||||||||||||||||||||||    
T  46449941 attaattgtaactagctagctgcatactagtattata 46449905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University