View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16429_low_3 (Length: 206)

Name: NF16429_low_3
Description: NF16429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16429_low_3
NF16429_low_3
[»] chr6 (2 HSPs)
chr6 (79-171)||(5467667-5467760)
chr6 (8-79)||(5467973-5468044)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 79 - 171
Target Start/End: Complemental strand, 5467760 - 5467667
Alignment:
Q  79 agccaaatttaacaacatccatggaaaattcgacaaatgatttcaatg-ggggaatggtagatctaccagaggaaacacacaaaagctaagcaa 171  Q
    |||| |||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||    
T  5467760 agcctaatttaacaacatcgacggaaaattcgacaaatgatttcaatggggggaatggtagatctactaggggaaacacacaaaagctaagcaa 5467667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 5468044 - 5467973
Alignment:
Q  8 gagtataatgttgaatgggcgaaattggtgtatctggaaggttcaggatataccgcatgggaccgaattgaa 79  Q
    ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||    
T  5468044 gagtataatgttgaatgggcgaaattggtgtatcttgacggttcaggatataccgcatgggaccaaattgaa 5467973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University