View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16428_low_4 (Length: 396)

Name: NF16428_low_4
Description: NF16428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16428_low_4
NF16428_low_4
[»] chr2 (1 HSPs)
chr2 (7-137)||(20129159-20129289)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 7 - 137
Target Start/End: Complemental strand, 20129289 - 20129159
Alignment:
Q  7 tcgaagaaaatcatgaatttgtccatgaatctgctccacctgaggagtcatccgcaagctagtagccattgtcgccggtgacaacagaatcgatcacccg 106  Q
    ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||    
T  20129289 tcgaaaaatatcatgaatttgtccatgaatctgctccacctgaggagtcatctgcaagctggtagccattgtcgccggtgacaacagaatcgatcacccg 20129190  T
Q  107 gcggaaaccctaggttgttgatttggggaag 137  Q
    |||||||||||||||||||| ||||| ||||    
T  20129189 gcggaaaccctaggttgttgttttggtgaag 20129159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University