View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16417_low_10 (Length: 243)

Name: NF16417_low_10
Description: NF16417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16417_low_10
NF16417_low_10
[»] chr4 (1 HSPs)
chr4 (12-224)||(2794575-2794787)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 2794575 - 2794787
Alignment:
Q  12 gagatgaaggggtcgaatttggagtcaattttggaggagttatatgttgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2794575 gagatgaaggggtcgaatttggagtcaattttggaggagttatatgctgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt 2794674  T
Q  112 acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaatgccggatacttgatttgga 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  2794675 acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaacgccggatgcttgatttgga 2794774  T
Q  212 taaccttgctttt 224  Q
    |||||||||||||    
T  2794775 taaccttgctttt 2794787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University