View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16416_low_28 (Length: 214)

Name: NF16416_low_28
Description: NF16416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16416_low_28
NF16416_low_28
[»] chr8 (2 HSPs)
chr8 (98-201)||(32482652-32482755)
chr8 (19-61)||(32482792-32482834)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 98 - 201
Target Start/End: Complemental strand, 32482755 - 32482652
Alignment:
Q  98 ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32482755 ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct 32482656  T
Q  198 tctc 201  Q
    ||||    
T  32482655 tctc 32482652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 32482834 - 32482792
Alignment:
Q  19 agagatctcgcgggaagaacggccgtgcagcatgcatatcatc 61  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  32482834 agagatctcgcgggaagaacggccgtgcagcatgcatatcatc 32482792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University