View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16414_high_11 (Length: 316)

Name: NF16414_high_11
Description: NF16414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16414_high_11
NF16414_high_11
[»] chr3 (2 HSPs)
chr3 (19-177)||(12364815-12364973)
chr3 (212-275)||(12364756-12364819)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 12364973 - 12364815
Alignment:
Q  19 gagctggtaatggttttaccatgaggattaacgaaaatgtgtgagtgttggtaatgatctggacaagtttcattggtctggaaagtaaatcagggattat 118  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||     
T  12364973 gagctggtaatggttttaccatgaggattaacggaaatgtgtgagtgttggtaatgatctggacaggtttcattggtctggaaagtaaatcagggattaa 12364874  T
Q  119 gtttcgatttcctttgatatgttttacagtgaaatcatacctcgaaaaccaatctttga 177  Q
    |||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||    
T  12364873 gttttgatttactttgatatgttttacagtaaaatcatacctcgaaaaccaatctttga 12364815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 12364819 - 12364756
Alignment:
Q  212 tttgaattcaagaatttttggaaaggaagaattatccatctgaacttcaaaatgataatgtaac 275  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  12364819 tttgaattcaagaatttttagaaaggaagaattatccatctgaacttcaaaatgataatgtaac 12364756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University