View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16408_low_14 (Length: 222)

Name: NF16408_low_14
Description: NF16408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16408_low_14
NF16408_low_14
[»] chr4 (1 HSPs)
chr4 (1-167)||(32650820-32650986)
[»] chr2 (2 HSPs)
chr2 (118-167)||(33854099-33854148)
chr2 (58-118)||(33854179-33854239)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 32650820 - 32650986
Alignment:
Q  1 gaatgaaagatttttgttttgagaaataaagagttgattnnnnnnngctaaccactataaatatcttctgtctccttcttcgattatgtggatatggggt 100  Q
    |||||||||||||||| ||||||||||||||||||||||       |||||||||| |||||||||||||||||||||||| ||| ||||||||||||||    
T  32650820 gaatgaaagatttttggtttgagaaataaagagttgattaaaaaaagctaaccactgtaaatatcttctgtctccttcttcaattgtgtggatatggggt 32650919  T
Q  101 tggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32650920 tggagttgtggagaggaaatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 32650986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 33854148 - 33854099
Alignment:
Q  118 aatcaaagtggaagaaggtgatagaaattggagaagaatgaatggcagta 167  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||    
T  33854148 aatcaaagtggacgaaggtgatagaaattggagaagaatgaatggcagta 33854099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 33854239 - 33854179
Alignment:
Q  58 taaatatcttctgtctccttcttcgattatgtggatatggggttggagttgtggagaggaa 118  Q
    |||||||||| ||||||||||||||||| |||||||||||| |||||||| ||||||||||    
T  33854239 taaatatcttttgtctccttcttcgattgtgtggatatgggtttggagttatggagaggaa 33854179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University