View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16406_low_5 (Length: 241)

Name: NF16406_low_5
Description: NF16406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16406_low_5
NF16406_low_5
[»] chr2 (2 HSPs)
chr2 (92-178)||(2412488-2412574)
chr2 (170-241)||(2411190-2411261)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 2412574 - 2412488
Alignment:
Q  92 cgatcaccgctatattttgtgcctaaaaggaagataattatttcaccactctgggagataattcccgaaacttttgggatgtatcta 178  Q
    |||||||| ||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
T  2412574 cgatcaccactatattttgtgcataaaaggaagataattatttcaccactctagaagataattcccgaaacttttgggatgtatcta 2412488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 170 - 241
Target Start/End: Complemental strand, 2411261 - 2411190
Alignment:
Q  170 atgtatctatcatacatatacattaggggtaaaacagttttccgaggataactttcacacccttcggctatg 241  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||    
T  2411261 atgtatctatcatacatatacattacgggtaaaacagttttccgaagataactttcaaacccttcggctatg 2411190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University