View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1639_low_36 (Length: 214)

Name: NF1639_low_36
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1639_low_36
NF1639_low_36
[»] chr4 (1 HSPs)
chr4 (11-197)||(2793988-2794174)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 2793988 - 2794174
Alignment:
Q  11 gtgagaagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaaggttataactgattttctgga 110  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  2793988 gtgacaagaagattaacattgagaaactgcttaaccctatcactgatactgtgtttaatcaccttgtttcgattggaaagcttataactgattttctgga 2794087  T
Q  111 gtttgaggatgttgagggtggttttgattcttttgacggtgttgcagtggaatttgaagagaatgaagatgatgatgagaaggatgt 197  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2794088 gtttgaggatgtggagggtggttttgattcttttgacggtgttgcagtggaatttgaagagaatgaagatgatgatgagaaggatgt 2794174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University