View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1639_high_24 (Length: 247)

Name: NF1639_high_24
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1639_high_24
NF1639_high_24
[»] chr8 (2 HSPs)
chr8 (1-101)||(14542100-14542200)
chr8 (173-236)||(14541963-14542026)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 14542200 - 14542100
Alignment:
Q  1 ttataaatcaatgaaatgtagtcattgaaattgacaattttctattagattagcttctccattataatttttaaaatcaatttcaaaatgattaatatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14542200 ttataaatcaatgaaatgtagtcattgaaattgacaattttctattagattagcttctccattataatttttaaaatcaatttcaaaatgattaatatga 14542101  T
Q  101 t 101  Q
    |    
T  14542100 t 14542100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 173 - 236
Target Start/End: Complemental strand, 14542026 - 14541963
Alignment:
Q  173 tgattcactctagttatttttcagtccttcaaattatatcttatttttcactcttgtatatatt 236  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  14542026 tgattcactctagttatttttcagtcctttaaattatatcttatttttcactcttgtatatatt 14541963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University