View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16398_low_5 (Length: 388)

Name: NF16398_low_5
Description: NF16398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16398_low_5
NF16398_low_5
[»] chr4 (1 HSPs)
chr4 (220-256)||(51035969-51036005)


Alignment Details
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 256
Target Start/End: Complemental strand, 51036005 - 51035969
Alignment:
Q  220 actatatttccacgttacacccttcacaataagcaac 256  Q
    ||||||||||||| | |||||||||||||||||||||    
T  51036005 actatatttccacttgacacccttcacaataagcaac 51035969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University