View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16395_high_49 (Length: 212)

Name: NF16395_high_49
Description: NF16395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16395_high_49
NF16395_high_49
[»] chr8 (1 HSPs)
chr8 (18-197)||(43389951-43390130)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 43390130 - 43389951
Alignment:
Q  18 acaaatgagaatccgccctagaatttgaaaaggttatatctgctacaaaataaatagttaaatatcagtttcttcagcttctgcaactcacgtatgacat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43390130 acaaatgagaatccgccctagaatttgaaaaggttatatctgctacaaaataaatagttaaatatcagtttcttcagcttctgcaactcacgtatgacat 43390031  T
Q  118 ttatggagggcttcttcaggtatcagaactctgaaaacagcataatgatggtttaagctcttttctccctgtaatctgtg 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43390030 ttatggagggcttcttcaggtatcagaactctgaaaacagcataatgatggtttaagctcttttctccctgtaatctgtg 43389951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University