View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16381_low_7 (Length: 449)

Name: NF16381_low_7
Description: NF16381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16381_low_7
NF16381_low_7
[»] chr1 (1 HSPs)
chr1 (111-202)||(50362544-50362635)
[»] chr6 (1 HSPs)
chr6 (377-433)||(8772566-8772622)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 50362544 - 50362635
Alignment:
Q  111 atattgcgagagaaagatatgttaatttttggagtttcaggactgttttcgcaaggcatttggcaaacatgtatggagattttgggttcttt 202  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||| | ||||||    
T  50362544 atattgcgagagaaagatatgtcaattattggagtttcaggactgttgttgcaaggcatttggcaaacatgtatggagatttttgcttcttt 50362635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 8772622 - 8772566
Alignment:
Q  377 tgagttttgtgtttgttacaagtgtaatagccctttgtggagttggttaatcaaata 433  Q
    ||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||    
T  8772622 tgagttttgtgtttgttacaagtataatacccctttgtggagttggctaatcaaata 8772566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University