View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16380_low_31 (Length: 249)

Name: NF16380_low_31
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16380_low_31
NF16380_low_31
[»] chr7 (1 HSPs)
chr7 (12-170)||(45085365-45085523)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 12 - 170
Target Start/End: Original strand, 45085365 - 45085523
Alignment:
Q  12 aagaaaacaacgattcaatttgctctaaaataattttagtttctttatttannnnnnnncnnnnnnnntgctctcaaaaaacaacaattaattttatcat 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||        |        ||||||||||||||||||||||||||||||||    
T  45085365 aagaaaacaacgattcaatttgctctaaaataattttagtttctttatttattttttttcaaaaaaaatgctctcaaaaaacaacaattaattttatcat 45085464  T
Q  112 tttcaaaatcaacgaagtacctatgacattctttagactaattcaacattttcactacc 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45085465 tttcaaaatcaacgaagtacctatgacattctttagactaattcaacattttcactacc 45085523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University