View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16380_high_38 (Length: 236)

Name: NF16380_high_38
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16380_high_38
NF16380_high_38
[»] chr3 (1 HSPs)
chr3 (12-217)||(43452364-43452569)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 43452569 - 43452364
Alignment:
Q  12 aagaaaatatgaaagaatattgtccgatgatgatgtgaaaatggttgttgaagacaatagagaggaatccctgtggggaatccgttaaggttgcagaatc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43452569 aagaaaatatgaaagaatattgtccgatgatgatgtgaaaatggttgttgaagacaatagagaggaatccctgtggggaatccgttaaggttgcagaatc 43452470  T
Q  112 agattatcaccaatgaaaagcctattatatgtttcctgagcttatctatgtcggtaacattactgatgcttgatggctcctggtttaaagataattccca 211  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43452469 agattatcaccaatgaaaagcctattatatgtttcctgggcttatctatgtcggtaacattactgatgcttgatggctcctggtttaaagataattccca 43452370  T
Q  212 gtttgc 217  Q
    ||||||    
T  43452369 gtttgc 43452364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University