View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16380_high_34 (Length: 240)

Name: NF16380_high_34
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16380_high_34
NF16380_high_34
[»] chr7 (1 HSPs)
chr7 (172-221)||(27039013-27039062)


Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 27039062 - 27039013
Alignment:
Q  172 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27039062 aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaa 27039013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University