View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16379_high_4 (Length: 565)

Name: NF16379_high_4
Description: NF16379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16379_high_4
NF16379_high_4
[»] chr3 (1 HSPs)
chr3 (452-549)||(1253574-1253671)
[»] chr2 (1 HSPs)
chr2 (472-526)||(2387-2441)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 8e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 452 - 549
Target Start/End: Original strand, 1253574 - 1253671
Alignment:
Q  452 aacataatgagaatttagcaggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattcacctaaggatagaaacatataat 549  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  1253574 aacataatgagaatttagcgggatgttacactctatcccactaaagaaaatttcgttctcgaaatttagaaattcacctaaggatagaaacatataat 1253671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 472 - 526
Target Start/End: Complemental strand, 2441 - 2387
Alignment:
Q  472 ggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattc 526  Q
    |||| |||||||||| |||||| ||  ||||||||||||||||||||||| ||||    
T  2441 ggatattacactctaccccccttaaagaaatttcgtcctcgaaatttagagattc 2387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University