View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16378_low_51 (Length: 369)

Name: NF16378_low_51
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16378_low_51
NF16378_low_51
[»] chr8 (2 HSPs)
chr8 (109-312)||(43037453-43037657)
chr8 (308-355)||(43037384-43037431)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 109 - 312
Target Start/End: Complemental strand, 43037657 - 43037453
Alignment:
Q  109 attcaacaacctccgcccccgctttccaccttgactatgccgctctccatcgtctctccggcaaactcctcac-ctctccatctttgtttacaacggccc 207  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  43037657 attcaacaacctccgcccccgctttccaccttgactatgctgctctccatcgtctctccggcaaactcctcactctctccatctttgtttacaacggccc 43037558  T
Q  208 aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaatattttccac 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  43037557 aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaatactttccac 43037458  T
Q  308 aatgg 312  Q
    |||||    
T  43037457 aatgg 43037453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 43037431 - 43037384
Alignment:
Q  308 aatggatgataaaccttcacatttgcttcacgttatggtccggtctga 355  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||    
T  43037431 aatggatgataaaccttcacatttgctacacgttatggtccggtctga 43037384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University