View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16378_low_122 (Length: 204)

Name: NF16378_low_122
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16378_low_122
NF16378_low_122
[»] chr2 (1 HSPs)
chr2 (16-186)||(1413718-1413888)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 1413718 - 1413888
Alignment:
Q  16 aaaattaaggaccaaaatcttaaatgagacaaaataaaaggattaaagttgtattaagccattaaaataaaagggtaaggagtgagaacctagtataatt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1413718 aaaattaaggaccaaaatcttaaatgagacaaaataaaaggattaaagttgtattaagccattaaaataaaagggtaaggagtgagaacctagtataatt 1413817  T
Q  116 ggaacctcagcatgaggtttaggaaagggataagtgtgtccatgtttgggataaatgatgacagccccatg 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1413818 ggaacctcagcatgaggtttaggaaagggataagtgtgtccatgtttgggataaatgatgacagccccatg 1413888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University