View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16378_high_96 (Length: 244)

Name: NF16378_high_96
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16378_high_96
NF16378_high_96
[»] chr2 (1 HSPs)
chr2 (73-225)||(41236481-41236632)


Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 73 - 225
Target Start/End: Original strand, 41236481 - 41236632
Alignment:
Q  73 tcttctgtgattttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatactcagactcaaagtttagttcactgcgtgtttaccaa 172  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
T  41236481 tcttctgtgactttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatacttagactcaaagtttagttcactgcatgtttaccaa 41236580  T
Q  173 agtttactaaaatttgagtttacagttagatcaacttgaaatagatcattaga 225  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  41236581 agtttactaaaatttgag-ttacagttagatcaacttgaaatagatcattaga 41236632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University