View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16368_high_8 (Length: 217)

Name: NF16368_high_8
Description: NF16368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16368_high_8
NF16368_high_8
[»] chr6 (1 HSPs)
chr6 (14-81)||(2768881-2768948)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 81
Target Start/End: Original strand, 2768881 - 2768948
Alignment:
Q  14 acatcatcaccgtaccgttcaagtaagannnnnnnctcttcactcgccaacccatttcctgattctgc 81  Q
    ||||||| ||| ||||||||||||||||       |||||||||||||||||||||||||||||||||    
T  2768881 acatcataaccataccgttcaagtaagatttttttctcttcactcgccaacccatttcctgattctgc 2768948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University