View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16367_low_1 (Length: 574)

Name: NF16367_low_1
Description: NF16367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16367_low_1
NF16367_low_1
[»] chr2 (1 HSPs)
chr2 (10-145)||(12830410-12830545)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 3e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 12830545 - 12830410
Alignment:
Q  10 attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaacataatcattttcggttttagtgatattaaat 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  12830545 attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaaaataatcattttcggttttagtgatattaaat 12830446  T
Q  110 ttgtagtgttcatattagtgatacttgcctcaaggt 145  Q
    ||||||||||||||||||||||||||||||||||||    
T  12830445 ttgtagtgttcatattagtgatacttgcctcaaggt 12830410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University