View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16358_low_12 (Length: 228)

Name: NF16358_low_12
Description: NF16358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16358_low_12
NF16358_low_12
[»] chr1 (1 HSPs)
chr1 (38-186)||(48766555-48766703)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 38 - 186
Target Start/End: Complemental strand, 48766703 - 48766555
Alignment:
Q  38 ataactccaaatgaatacacatccgatttggggtttgattttatgttttgaaacgattctggtgcttggtatggcacttgacccccacaagtagatgatg 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48766703 ataactccaaatgaatacacatccgatttggggtttgattttatgttttgaaacgattctggtgcttggtatggcacttgacccccacaagtagatgatg 48766604  T
Q  138 atggccccattgtcccataggggctaggagttgaaccaatggaaatgtc 186  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||    
T  48766603 atggccccattgttccataggggctaggagttgaaccaatggaaatgtc 48766555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University