View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16356_high_8 (Length: 336)

Name: NF16356_high_8
Description: NF16356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16356_high_8
NF16356_high_8
[»] chr2 (1 HSPs)
chr2 (85-307)||(37757279-37757501)
[»] scaffold1717 (1 HSPs)
scaffold1717 (129-192)||(397-460)
[»] scaffold1527 (1 HSPs)
scaffold1527 (129-192)||(643-706)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 85 - 307
Target Start/End: Complemental strand, 37757501 - 37757279
Alignment:
Q  85 gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37757501 gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt 37757402  T
Q  185 gtagttgtaaggtatccggaggagagtaatggcggcggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaac 284  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37757401 gtagttgtaaggtatccggaggagagtaatggcggtggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaac 37757302  T
Q  285 atgaagatgagtatcatgatgct 307  Q
    |||||||||||||||||||||||    
T  37757301 atgaagatgagtatcatgatgct 37757279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1717 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1717
Description:

Target: scaffold1717; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 192
Target Start/End: Complemental strand, 460 - 397
Alignment:
Q  129 atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt 192  Q
    ||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| |||||    
T  460 atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt 397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1527 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1527
Description:

Target: scaffold1527; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 192
Target Start/End: Complemental strand, 706 - 643
Alignment:
Q  129 atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt 192  Q
    ||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| |||||    
T  706 atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt 643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University