View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16351_high_5 (Length: 224)

Name: NF16351_high_5
Description: NF16351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16351_high_5
NF16351_high_5
[»] chr7 (1 HSPs)
chr7 (12-209)||(48649573-48649770)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 209
Target Start/End: Original strand, 48649573 - 48649770
Alignment:
Q  12 ataatactaactatattactctgtctcttattatatctcagagatactgataagtagtaacgtgcacccaaatatttttgttagtgagtgatcatcatca 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48649573 ataatactaactatattactctgtctcttattatatctcagagatactaataagtagtaacgtgcacccaaatatttttgttagtgagtgatcatcatca 48649672  T
Q  112 ttcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaattagat 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  48649673 ttcatcaaattccttctttcttatagactgactagttagtattaattagtagcagccgggtgaaccaactgatatttagagagatcaatcaaatagat 48649770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University