View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16340_high_4 (Length: 268)

Name: NF16340_high_4
Description: NF16340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16340_high_4
NF16340_high_4
[»] chr1 (1 HSPs)
chr1 (1-252)||(52543147-52543398)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 52543147 - 52543398
Alignment:
Q  1 tccaccactctaccttgccaagaattcccaaaacactcgtcgtcaaccagtgattcgcggcgcgccacatgttttgcagccatgacagccgtcaattctt 100  Q
    ||||||||||||||||   | |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||    
T  52543147 tccaccactctacctttggacgaattcccaaaacactcgtcgtcaaccaatgattcgcggagcgccacatgttttgcagccataacagccgtcaattctt 52543246  T
Q  101 tgggaatattcaaccgggcagaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattgagtatagac 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52543247 tgggaatattcaaccgggccgaataacaaaccctaatggctggtgtgtcctgacaagggaaaacagaacgggcatgaatggcttggcattgagtatagac 52543346  T
Q  201 aaaagggtgttttttgtcgaaagtttgaggaggtaagagccattgaagagca 252  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  52543347 aaaagggtgttttttgttgaaagtttgaggaggtaagagccattgaagagca 52543398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University