View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16338_low_1 (Length: 241)

Name: NF16338_low_1
Description: NF16338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16338_low_1
NF16338_low_1
[»] chr5 (2 HSPs)
chr5 (1-223)||(23220320-23220542)
chr5 (167-203)||(23171882-23171918)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 23220542 - 23220320
Alignment:
Q  1 aacaaataaattaacaataaagcgtaaacaagagttttgaggagaaattagatgtacataccctttgcctccgctgaaatcaaagagtggtaaagacgaa 100  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23220542 aacaaataaattaacaataaagcgtaaacaagggttttcaggagaaattagatgtacataccctttgcctccgctgaaatcaaagagtggtaaagacgaa 23220443  T
Q  101 acagctctcacatggtgaactgaccggagtaccggtggattgaacggccggcgaagaaacgggaaagtgggagatttaccggcgaggtgaaacgacgtag 200  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  23220442 acagctctcacatggtgaactgaccggagcgccggtggattgaacggccggcgaagaaacgggaaagtgggagatttacctgcgaggtgaaacgacgtag 23220343  T
Q  201 tatttaggagtaataaggaagga 223  Q
    |||| ||||||||||||||||||    
T  23220342 tattgaggagtaataaggaagga 23220320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 23171918 - 23171882
Alignment:
Q  167 gtgggagatttaccggcgaggtgaaacgacgtagtat 203  Q
    |||||||||||||||| ||||||| ||||||||||||    
T  23171918 gtgggagatttaccggagaggtgagacgacgtagtat 23171882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University