View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16336_low_1 (Length: 260)

Name: NF16336_low_1
Description: NF16336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16336_low_1
NF16336_low_1
[»] chr2 (1 HSPs)
chr2 (16-246)||(155099-155329)
[»] chr4 (1 HSPs)
chr4 (16-245)||(56469226-56469455)
[»] chr6 (1 HSPs)
chr6 (43-158)||(24329119-24329234)


Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 155099 - 155329
Alignment:
Q  16 gtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtttctggtc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  155099 gtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtttctggtc 155198  T
Q  116 cactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgacagaacatcacggatttccagtagttgatgagcctccttt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  155199 cactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgacagaacatcacggatttccagtagttgatgagcctccttt 155298  T
Q  216 gacggatgctccggagttgtgtgggttggtg 246  Q
    |||||||||||| ||||||||||||||||||    
T  155299 gacggatgctcccgagttgtgtgggttggtg 155329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 56469455 - 56469226
Alignment:
Q  16 gtttatgatcagattgtggcgttgaagggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtttctggtc 115  Q
    ||||||||||| || ||||   |||||||  | |||||| ||||||  |||||||| || ||||||||| |||||||||| || ||||||||||||||||    
T  56469455 gtttatgatcaaatagtggaaatgaaggggttgccttatttggaagtgcatgcagaaccgtacatgaggcatttagttgccggtgatgttgtttctggtc 56469356  T
Q  116 cactgttttctttttgtgggatcgaaaaagtggggaatatattgcacgctttgaaagtgacagaacatcacggatttccagtagttgatgagcctccttt 215  Q
    |||||||| | || | ||| || |||||||||||||||||  ||||| |||| || |||||   |||| | || ||||| ||  ||||||||||||| ||    
T  56469355 cactgtttacattctctggtattgaaaaagtggggaatattgtgcacactttaaaggtgacgcgacataatgggtttcctgtgattgatgagcctccatt 56469256  T
Q  216 gacggatgctccggagttgtgtgggttggt 245  Q
        || ||||| ||||| |||||||||||    
T  56469255 cttagaagctccagagttatgtgggttggt 56469226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 43 - 158
Target Start/End: Complemental strand, 24329234 - 24329119
Alignment:
Q  43 ggactaccttatatggaagcacatgcagagccatacatgaggaatttagttgcaggggatgttgtttctggtccactgttttctttttgtgggatcgaaa 142  Q
    ||||| |||||| ||||||||||||| || || |||||||||||| ||| | || | |||||||| || |||||| || |  | |||| ||| |||||||    
T  24329234 ggacttccttatttggaagcacatgccgaaccttacatgaggaatatagctacacgtgatgttgtctcgggtccattgatgaccttttctggcatcgaaa 24329135  T
Q  143 aagtggggaatatatt 158  Q
    | || |||||||||||    
T  24329134 aggttgggaatatatt 24329119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University