View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1632_high_63 (Length: 221)

Name: NF1632_high_63
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1632_high_63
NF1632_high_63
[»] chr4 (6 HSPs)
chr4 (17-203)||(39520566-39520752)
chr4 (17-203)||(39510308-39510494)
chr4 (17-162)||(39524092-39524237)
chr4 (17-166)||(39575242-39575391)
chr4 (106-183)||(39579761-39579838)
chr4 (106-166)||(39543407-39543467)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 39520752 - 39520566
Alignment:
Q  17 caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac 116  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||    
T  39520752 caaaggcctgttgagaattccgaatggttgcccattccagctgccagaggagggagttctcacagcagattaactgatgcaacaacaattcaaggctcac 39520653  T
Q  117 ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataatttcaatgtgaagaggataattg 203  Q
    |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||  |||||||| ||||    
T  39520652 ctttacctaacataaaccttggattgaaaatccctttgcttgatcttcaatttgcaacggataatttcgatgcaaagaggattattg 39520566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 39510494 - 39510308
Alignment:
Q  17 caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac 116  Q
    |||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||| |    
T  39510494 caaaggcctgttgaaaattccgaatggttgccaattccagctgccagaggagggagttctcacagcagattaactgatgcaacagcaattcaaggctccc 39510395  T
Q  117 ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataatttcaatgtgaagaggataattg 203  Q
    |||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| ||||| ||  |||  |||||||||||||    
T  39510394 ctttacctaacataaacctcggattgaaaatccccttgcttgatcttcaattcgcaacggataactttgatgcaaagaggataattg 39510308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 39524237 - 39524092
Alignment:
Q  17 caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac 116  Q
    ||||||||||||||||| ||| |||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||| | ||||||||||| |    
T  39524237 caaaggcctgttgagaagtccgaatggttgcctattccagctgccagaggaggaagttctcacagcagattaactgatgcaacaacaattcaaggctcgc 39524138  T
Q  117 ctttacctaacataaatcttggattgaaaatccccttgcttgatct 162  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||    
T  39524137 ctttacctaacataaaccttggattgaaaatccctttgcttgatct 39524092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 17 - 166
Target Start/End: Complemental strand, 39575391 - 39575242
Alignment:
Q  17 caaaggcctgttgagaattccaaatggttgcccattccagctgccagaggagggagttctcacggcagattaactgatgcaacatccattcaaggctcac 116  Q
    |||||||||||||||| || | | | |||||| |||||| ||||   |||||||| ||||||  ||| ||||||| ||| || | | | |||||||||||    
T  39575391 caaaggcctgttgagagtttcgatttgttgccgattccaactgctgcaggagggatttctcatagcaaattaacttatggaaaaacaactcaaggctcac 39575292  T
Q  117 ctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaa 166  Q
    |||||||||||||||| |||||  |||||||| |||||||||| ||||||    
T  39575291 ctttacctaacataaaccttggcatgaaaatctccttgcttgaccttcaa 39575242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 183
Target Start/End: Complemental strand, 39579838 - 39579761
Alignment:
Q  106 tcaaggctcacctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaatttgcaactgataattt 183  Q
    ||||||||| ||||||||||||||||| |||||  |||||||| ||||||||||||||||||| ||||| || |||||    
T  39579838 tcaaggctcgcctttacctaacataaaccttggcctgaaaatctccttgcttgatcttcaattcgcaacagagaattt 39579761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 106 - 166
Target Start/End: Complemental strand, 39543467 - 39543407
Alignment:
Q  106 tcaaggctcacctttacctaacataaatcttggattgaaaatccccttgcttgatcttcaa 166  Q
    ||||||||||||||||||||||||||| |||||  |||||||| |||||||||| ||||||    
T  39543467 tcaaggctcacctttacctaacataaaccttggcatgaaaatctccttgcttgaccttcaa 39543407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University