View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1632_high_43 (Length: 288)

Name: NF1632_high_43
Description: NF1632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1632_high_43
NF1632_high_43
[»] chr8 (1 HSPs)
chr8 (16-199)||(34719579-34719762)


Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 34719762 - 34719579
Alignment:
Q  16 taatgactatgtttactatctctctcttctcgtgttatattcatgatagaagttttaataacaatatcatttctgttttcaaacattgtaatgttcagta 115  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34719762 taatgactatgtttactatctgtctcttctcgtgttatattcatgatagaagttttaataacaatatcatttctgttttcaaacattgtaatgttcagta 34719663  T
Q  116 aaaacggttttttgttggtttctattcaaagtttagtaaacaggacttaaaataaaaatgagatgatatttttataaactgaaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  34719662 aaaacggttttttgttggtttctattcaaagtttagtaaacaggacttaaaataaaaatgagatgatgtttttataaactgaaa 34719579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University