View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16328_low_4 (Length: 307)

Name: NF16328_low_4
Description: NF16328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16328_low_4
NF16328_low_4
[»] chr8 (1 HSPs)
chr8 (31-296)||(38829620-38829885)


Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 31 - 296
Target Start/End: Complemental strand, 38829885 - 38829620
Alignment:
Q  31 tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcaatgatcgattcaccctgcttcattgctaagacctcaaagtctcggc 130  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||    
T  38829885 tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggc 38829786  T
Q  131 gtagacgattgagctgtgctctcttcactcgagcattgccgcgacacttcaacttcatggaatcccatagctgtttagatgtctccttctgcgtgatggt 230  Q
    ||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||    
T  38829785 gtagatgattgagttgtgctctcttcactcgagcattgtcgcgacacttcaacttcatggaatcccatagccgtttagatgtctccttctgcgtgttcgt 38829686  T
Q  231 cttcagaattgacttgtcaattgactgaaacaagtaattcttagccttcaaatccttcagcttcat 296  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  38829685 cttcagaattgacttgtcaattaactgaaacaagtaattcttagccttcaaatccttcagcttcat 38829620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University