View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16327_low_1 (Length: 382)

Name: NF16327_low_1
Description: NF16327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16327_low_1
NF16327_low_1
[»] chr8 (1 HSPs)
chr8 (305-365)||(2685317-2685377)
[»] chr4 (2 HSPs)
chr4 (305-365)||(5477937-5477997)
chr4 (63-114)||(26465414-26465465)
[»] chr2 (1 HSPs)
chr2 (305-365)||(45008741-45008801)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 2685377 - 2685317
Alignment:
Q  305 aaaatggtttttgaagaattagcaattgatagcggaattgaggttcttaaatgtctaatat 365  Q
    |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  2685377 aaaacggtttttgaagaattagcaattgatagcagaattgaggttcttaaatgtctaatat 2685317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 365
Target Start/End: Original strand, 5477937 - 5477997
Alignment:
Q  305 aaaatggtttttgaagaattagcaattgatagcggaattgaggttcttaaatgtctaatat 365  Q
    |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  5477937 aaaacggtttttgaagaattagcaattgatagcagaattgaggttcttaaatgtctaatat 5477997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 63 - 114
Target Start/End: Complemental strand, 26465465 - 26465414
Alignment:
Q  63 ttatgtggtactgaaaaataccttagctatgatgataatttggttgatggat 114  Q
    |||||||  |||||||||||| |||||||||||||||| || ||||||||||    
T  26465465 ttatgtgacactgaaaaatactttagctatgatgataaattagttgatggat 26465414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 45008801 - 45008741
Alignment:
Q  305 aaaatggtttttgaagaattagcaattgatagcggaattgaggttcttaaatgtctaatat 365  Q
    |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  45008801 aaaacggtttttgaagaattagcaattgatagcagaattgaggttcttaaatgtctaatat 45008741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University