View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16323_high_1 (Length: 276)

Name: NF16323_high_1
Description: NF16323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16323_high_1
NF16323_high_1
[»] chr2 (1 HSPs)
chr2 (3-266)||(4822100-4822363)
[»] chr6 (1 HSPs)
chr6 (142-231)||(9431348-9431437)
[»] chr5 (1 HSPs)
chr5 (176-233)||(18188137-18188194)


Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 3 - 266
Target Start/End: Original strand, 4822100 - 4822363
Alignment:
Q  3 atggacatcatcagaactagcagcttcgtagagacaactttccggtgaaccactatcctcgtgaccgggtggcttggccttccgacgaccagctccaacc 102  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4822100 atggccatcatcagaactagcagcttcgtagagacaactttccggtgaaccactatcctcgtgaccgggtggcttggccttccgacgaccagctccaacc 4822199  T
Q  103 ggaacgttacgcagggccccaccagccgtccagtacctttgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4822200 ggaacgttacgcagggccccaccagccgtccagtacctttgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatt 4822299  T
Q  203 tagtttccatactcttgcatcttggacatggtatgatcttttctatcttcttctccaccctttg 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  4822300 tagtttccatactcttgcatcttggacatggtatgatcttttctatcttcttctccaccgtttg 4822363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 231
Target Start/End: Original strand, 9431348 - 9431437
Alignment:
Q  142 tgacaactcttacaaaaatgtcttggttgattaacgttgtaattattgaaataacaaaatttagtttccatactcttgcatcttggacat 231  Q
    |||||||||  ||||||||| |  |||||||| || ||||| || ||||||||||||||||| || || | ||| |||||||||||||||    
T  9431348 tgacaactccgacaaaaatgccgaggttgattgacattgtagttgttgaaataacaaaattttgtgtcgaaacttttgcatcttggacat 9431437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 233
Target Start/End: Complemental strand, 18188194 - 18188137
Alignment:
Q  176 cgttgtaattattgaaataacaaaatttagtttccatactcttgcatcttggacatgg 233  Q
    |||||||||||||| | ||||||||||| || ||||| || |||||||||||||||||    
T  18188194 cgttgtaattattgtagtaacaaaattttgtgtccatgcttttgcatcttggacatgg 18188137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University