View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1629_low_24 (Length: 213)

Name: NF1629_low_24
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1629_low_24
NF1629_low_24
[»] chr5 (1 HSPs)
chr5 (15-157)||(33498910-33499051)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 33498910 - 33499051
Alignment:
Q  15 aattaattcattgattacatctttaaattggctaaatataggaaatgcaaattttattttccgtgagcttcaataatttttatacatctttttccgaaat 114  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||    
T  33498910 aattgattcattgattacatctttaaattggctaaatataggaaatgcaaattttattttccgtgagcttcaataa-ttttatacatctatttccgaaat 33499008  T
Q  115 gataaataagcatactctataggaaaagattacttgtatagta 157  Q
    ||||||||| ||||||||||||||||||||||||||| |||||    
T  33499009 gataaataatcatactctataggaaaagattacttgtctagta 33499051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University