View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1629_low_18 (Length: 235)

Name: NF1629_low_18
Description: NF1629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1629_low_18
NF1629_low_18
[»] chr2 (1 HSPs)
chr2 (7-200)||(10604801-10604994)
[»] chr3 (1 HSPs)
chr3 (51-117)||(32212875-32212941)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 200
Target Start/End: Complemental strand, 10604994 - 10604801
Alignment:
Q  7 tgaatataataatatgttactagataaaaagagagtagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaa 106  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10604994 tgaatataataatatgttactagataaaaagaaagtagaacacttacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaa 10604895  T
Q  107 atccatgcttgacaatgatctgaaatactagcaaccaattgttaaccccatgtcagacaattcaggagaggtttgcttcatttaataatttaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||    
T  10604894 atccatgcttgacaatgatctgaaatactagcaaccaattgttaaacccatgtcagacaactcaggagaggtttacttcatttaataatttaag 10604801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 32212941 - 32212875
Alignment:
Q  51 tacaaaatctgcaattcagatagtgatccaatttctgaagaaagctggccagacaaatccatgcttg 117  Q
    |||||||||  ||||||||||||| ||||||| | |   ||||||| ||||||||||||||||||||    
T  32212941 tacaaaatccacaattcagatagtaatccaatatgttctgaaagctagccagacaaatccatgcttg 32212875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University