View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16288_low_9 (Length: 243)

Name: NF16288_low_9
Description: NF16288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16288_low_9
NF16288_low_9
[»] chr4 (1 HSPs)
chr4 (2-243)||(18551189-18551430)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 18551189 - 18551430
Alignment:
Q  2 gaaatgaatggcagcaaagagcgggttgacatcatacttagggccagccctggaaaattggataaggtcaaaaataccaaaagttttaccaaagttggga 101  Q
    |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18551189 gaaatgaatggcaggaaagagcaggttgacatcatacttagggccagccctggaaaattggataaggtcaaaaataccaaaagttttaccaaagttggga 18551288  T
Q  102 ttttttaagttctattttgtctgaacacttgacataagtaaggttactagtggaatgggctgatcaaaacactttatgtgttgtattcatgaaactcata 201  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18551289 ttttttaagttctattttgtctgaccacttgacataagtaaggttactagtggaatgggctgatcaaaacactttatgtgttgtattcatgaaactcata 18551388  T
Q  202 ttataaggaccttcagagaatatcttgggggtttcaccctca 243  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
T  18551389 ttataaggaccttcagagaatatcttgggggttgcaccctca 18551430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University