View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16283_low_10 (Length: 281)

Name: NF16283_low_10
Description: NF16283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16283_low_10
NF16283_low_10
[»] chr4 (2 HSPs)
chr4 (7-241)||(9171814-9172049)
chr4 (33-62)||(9159415-9159444)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 9171814 - 9172049
Alignment:
Q  7 gtgaaaagaagtggaactttagtatctcatctacaatatttggatgatactttgtgccnnnnnnnntattcttaaacggattgttgtcacgctgttgctt 106  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |         |||||||||||||||||||||||| ||||||||    
T  9171814 gtgaaaagaagaggaactttagtatctcatctacaatatttggatgatactttgtgtcaaaaaaaaaattcttaaacggattgttgtcacgttgttgctt 9171913  T
Q  107 ctacttggtgttgtt-cctttcgttgtcattgttttcaccgccgcatttctcagtacaaaataccacctctgaacatgtcattgacgtcggcgcaaggga 205  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  9171914 ctacttggtgttgttgcctttcattgtcattgttttcaccgccgcatttctcagtacaaaataccacctctgaacgtgtcattgacgtcggcgcaaggga 9172013  T
Q  206 tttctgattcaggggagattcattagcaacgccgac 241  Q
    ||||||||| ||||||||||||| || |||||||||    
T  9172014 tttctgatttaggggagattcatcagaaacgccgac 9172049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 62
Target Start/End: Complemental strand, 9159444 - 9159415
Alignment:
Q  33 tcatctacaatatttggatgatactttgtg 62  Q
    ||||||||||||||||||||||||||||||    
T  9159444 tcatctacaatatttggatgatactttgtg 9159415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University