View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16281_low_55 (Length: 213)

Name: NF16281_low_55
Description: NF16281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16281_low_55
NF16281_low_55
[»] chr2 (1 HSPs)
chr2 (13-200)||(22348067-22348257)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 22348257 - 22348067
Alignment:
Q  13 agcagagagccagcgctggagttcaggcgccaggaaccatcagaaacgcaattttcgttgcaaatgagcgtagaattgatcctactactagggttgatta 112  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22348257 agcagagagccagtgctggagttcaggcgccaggaaccatcagaaacgcaattttcattgcaaatgagcgtagaattgatcctactactagggttgatta 22348158  T
Q  113 tgttaatgcaaagttaataatgttggtgctat---aatatggtaaaggctgccagatgtatttacatatctatgtactgtatgatgaaact 200  Q
    ||||||||||||||||||||||||||||||||    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  22348157 tgttaatgcaaagttaataatgttggtgctatcgatatatggtaatggctgccagatgtatttacatatctatgtactgtatgatgaaact 22348067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University