View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1627_high_69 (Length: 221)

Name: NF1627_high_69
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1627_high_69
NF1627_high_69
[»] chr3 (1 HSPs)
chr3 (117-160)||(8591037-8591080)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 8591080 - 8591037
Alignment:
Q  117 ataatgaactcttgcatattctcaccaataataatgatcccctc 160  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||    
T  8591080 ataatcaactcttgcatattctcaccaataataatgatcacctc 8591037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University