View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1627_high_53 (Length: 259)

Name: NF1627_high_53
Description: NF1627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1627_high_53
NF1627_high_53
[»] chr7 (2 HSPs)
chr7 (1-185)||(38752377-38752561)
chr7 (212-240)||(38752312-38752340)
[»] chr1 (1 HSPs)
chr1 (1-78)||(30904159-30904236)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 38752561 - 38752377
Alignment:
Q  1 cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggtttgttcatctctcgtgatcttaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  38752561 cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccagcaacaggtttgttcatctctcgtgatcttaaa 38752462  T
Q  101 ctgaaaaccctagatggtatacgcttacannnnnnnnctcttcataattgcaaagaagaatttaaattaattaattaacaatagt 185  Q
    ||||||||||||||||||||||| |||||        ||||||||||||||||||||||||||||||||||||||||||||||||    
T  38752461 ctgaaaaccctagatggtatacgtttacattttttttctcttcataattgcaaagaagaatttaaattaattaattaacaatagt 38752377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 38752340 - 38752312
Alignment:
Q  212 aatatatttgacaaaatcacgatggcatc 240  Q
    |||||||||||||||||||||||||||||    
T  38752340 aatatatttgacaaaatcacgatggcatc 38752312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 30904159 - 30904236
Alignment:
Q  1 cttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggttt 78  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||| || |||||||||||||    
T  30904159 cttatgaagctcaagctagacttcaagatcctatttatggatgtgtttcacatatttttgccctacaacaacaggttt 30904236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University