View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16278_low_5 (Length: 250)

Name: NF16278_low_5
Description: NF16278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16278_low_5
NF16278_low_5
[»] chr7 (2 HSPs)
chr7 (1-91)||(35491337-35491427)
chr7 (2-85)||(35497570-35497652)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35491337 - 35491427
Alignment:
Q  1 ttagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttatagtaatg 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  35491337 ttagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttataataatg 35491427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 2 - 85
Target Start/End: Original strand, 35497570 - 35497652
Alignment:
Q  2 tagtgtgtactgatgcaatgcaatatattattggcaattatatgatgaagatttcactaattttttgttttccataagcttata 85  Q
    |||||| |||| |||| ||||||| || |||||||||||||||||||||||||| ||||||||||| |||| | || |||||||    
T  35497570 tagtgtctactaatgccatgcaat-tactattggcaattatatgatgaagattttactaattttttatttttcctatgcttata 35497652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University