View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16275_low_35 (Length: 222)

Name: NF16275_low_35
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16275_low_35
NF16275_low_35
[»] chr1 (1 HSPs)
chr1 (12-204)||(8438504-8438697)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 8438504 - 8438697
Alignment:
Q  12 agaagaaggaagggaatgaagggtagggaatgaaattggtatagaagggattgagggtttgcatatgaaattgattgtagccatcggagaagagaaagca 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8438504 agaagaaggaagggaatgaagggtagggaatgaaattggtatagaagggattgagggtttgcatatgaaattgattgtagccatcggagaagagaaagca 8438603  T
Q  112 gagaaacaagagttggaggagattgggaaagaagagtatgggaa-tgataaaaaatcatatcctctttgcttaattcatatgtggtacttattc 204  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  8438604 gagaaacaagagttggaggagattgggaaagaagagtatgggaattgataaaaaatcatatcctctttgcttaattcatatgtggtacttattc 8438697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University