View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16275_low_29 (Length: 243)

Name: NF16275_low_29
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16275_low_29
NF16275_low_29
[»] chr8 (1 HSPs)
chr8 (14-208)||(4357641-4357835)
[»] chr6 (1 HSPs)
chr6 (143-177)||(9984675-9984709)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 4357835 - 4357641
Alignment:
Q  14 agagtccatctagtaacacgattgttcaatataagtcactcaaattactcaattgatcgggtcataacccacgctcgatgaatatttttcgtgagtaaaa 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||    
T  4357835 agagcccatctagtaacacgattgttcaatataagtcactcaaattactcaattgatcgggtcataacccaccctcgatgaatattttttgtgagtaaaa 4357736  T
Q  114 ctcgatcgcgactgtaacctttgaatggttatttttctgaaaatgtgagcaatttgaggggcttttaccatcatataatgcaaaccacattcata 208  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||    
T  4357735 ctcgatcgcggctgtaacctttgaatggttatttttctgaaaatgtgagcagtttgaggggctattaccatcatataatgcaaaccacactcata 4357641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 177
Target Start/End: Complemental strand, 9984709 - 9984675
Alignment:
Q  143 tatttttctgaaaatgtgagcaatttgaggggctt 177  Q
    ||||||||||||| |||||||||||||||||||||    
T  9984709 tatttttctgaaattgtgagcaatttgaggggctt 9984675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University