View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16275_high_34 (Length: 205)

Name: NF16275_high_34
Description: NF16275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16275_high_34
NF16275_high_34
[»] chr3 (1 HSPs)
chr3 (16-188)||(43278891-43279062)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 43278891 - 43279062
Alignment:
Q  16 attatactgttatatatgtgtttagagacataggatggaaagttgggagatagtggtgtgtgaactgtttttacgggttaatgtatcaggggaagttgtg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43278891 attatactgttatatatgtgtttagagacataggatggaaagttgggagatagtggtgtgtgaactgtttttacgggttaatgtatcaggggaagttgtg 43278990  T
Q  116 aaggattgattggcatcaattgaatttggaactagtgaaaaggtcatttacgagggagagaaaaggtcactat 188  Q
    |||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  43278991 aaggattgatcggcatc-attgaatttggaaccagtgaaaaggtcatttacgagggagagaaaaggtcactat 43279062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University