View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16265_low_46 (Length: 234)

Name: NF16265_low_46
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16265_low_46
NF16265_low_46
[»] chr4 (2 HSPs)
chr4 (1-87)||(52117627-52117713)
chr4 (187-217)||(52117496-52117526)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 52117713 - 52117627
Alignment:
Q  1 tttttcttctctcttgtttctatcgtattgacnnnnnnnaagtagcactcttgcattttatcactcaaatgctacaaaccatctcac 87  Q
    ||||||||| ||||||||||| ||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||    
T  52117713 tttttcttcactcttgtttctctcgtattgactttttttaagtagcactcttgcattttatcactcaaatgctacaaaccatctcac 52117627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 217
Target Start/End: Complemental strand, 52117526 - 52117496
Alignment:
Q  187 cacaattaatcaaattactcaaccaagataa 217  Q
    |||||||||||||||||||||||||||||||    
T  52117526 cacaattaatcaaattactcaaccaagataa 52117496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University