View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16260_low_14 (Length: 204)

Name: NF16260_low_14
Description: NF16260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16260_low_14
NF16260_low_14
[»] chr2 (2 HSPs)
chr2 (7-188)||(20967041-20967222)
chr2 (7-188)||(20979853-20980039)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 188
Target Start/End: Complemental strand, 20967222 - 20967041
Alignment:
Q  7 tggaggaacacagaactaggttacagtcttcgttcttcacttgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata 106  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |||| ||||||||    
T  20967222 tggaggaaccaagaactaggttacagtcttcgttcttcacttgatagtgattgagtacaaaatctttggaaatggttataaactgactaggaaaggaata 20967123  T
Q  107 gtctttgttcttgcacgaaaacattgtgaggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  20967122 gtctttgttcttgcacgaaaacattgtgaggtgtttagggttttgtggagatgatttaatgaggtgcattttggcgaaggtg 20967041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 7 - 188
Target Start/End: Complemental strand, 20980039 - 20979853
Alignment:
Q  7 tggaggaacacagaactaggttacagtcttcgttcttcacttgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata 106  Q
    |||||||||  |||||  |||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20980039 tggaggaaccaagaacccggttacagtcttcgttattaaattgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata 20979940  T
Q  107 gtctttgttcttgcacgaaaacattgtga-----ggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg 188  Q
    |||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20979939 gtctttgttcttgcacgaaaacattgtgaggtgaggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg 20979853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University