View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16259_high_17 (Length: 215)

Name: NF16259_high_17
Description: NF16259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16259_high_17
NF16259_high_17
[»] chr5 (1 HSPs)
chr5 (35-196)||(10984943-10985104)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 35 - 196
Target Start/End: Original strand, 10984943 - 10985104
Alignment:
Q  35 ctgggctgtgattgctataggatggggtactataggttctgctgtgataattgctttgccaataatagagagctgggataccatccaaactgttattcta 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10984943 ctgggctgtgattgctataggatggggtactataggttctgctgtgataattgctttgccaataatagagagctgggataccatccaaactgttattcta 10985042  T
Q  135 ggaatgtttacaaatgacagactcgtggaaaaggtggatgagttaaatttcaagttgcatac 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10985043 ggaatgtttacaaatgacagactcgtggaaaaggtggatgagttaaatttcaagttgcatac 10985104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University