View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16258_low_21 (Length: 297)

Name: NF16258_low_21
Description: NF16258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16258_low_21
NF16258_low_21
[»] chr7 (1 HSPs)
chr7 (20-249)||(38982388-38982613)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 38982388 - 38982613
Alignment:
Q  20 attaaatagagataaattctaagacatcgatgcagacatactcgggagggagggtatggttctctctcctctccctaaccgtttttctccggtgaattta 119  Q
    |||||||||||||||||||||||||||||||||||| | ||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  38982388 attaaatagagataaattctaagacatcgatgcagagaaactcggga----gggtatggttctctctcctctccctaaccgtttttctccggtgaattta 38982483  T
Q  120 tctaccttcggtgcagctccggtggccgttttttcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgctt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38982484 tctaccttcggtgcagctccggtggccgttttttcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgctt 38982583  T
Q  220 ctctccgcgggctttttgcgtctttgtgtt 249  Q
    ||||||||||||||||||| |||| |||||    
T  38982584 ctctccgcgggctttttgcctcttagtgtt 38982613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University