View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16256_low_53 (Length: 241)

Name: NF16256_low_53
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16256_low_53
NF16256_low_53
[»] chr1 (2 HSPs)
chr1 (12-158)||(37058253-37058399)
chr1 (185-223)||(37058419-37058457)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 37058253 - 37058399
Alignment:
Q  12 agaagcaaaggggtgaagagaaaaaatagtgagaatcctatgcaaaatatacattgtctgtcggaaatacttttatacccaaaaaatttaatatgcttca 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  37058253 agaagcaaaggggtgaagagaaaaaatagtgagaatcctatgcaaaatatacattgtctgtcggaaatacttttatacccaaaaattttaatatgcttca 37058352  T
Q  112 tggttttttctacattccccttgatcaattggaaataattaaccttt 158  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||    
T  37058353 tggttttttctacattccccttgatgaattggaaataattaaccttt 37058399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 223
Target Start/End: Original strand, 37058419 - 37058457
Alignment:
Q  185 tctctttttcttcatttttatttatcattggggtaaact 223  Q
    |||||||||||||||||||||||||||||||||||||||    
T  37058419 tctctttttcttcatttttatttatcattggggtaaact 37058457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University