View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1624_high_52 (Length: 233)

Name: NF1624_high_52
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1624_high_52
NF1624_high_52
[»] chr8 (1 HSPs)
chr8 (1-105)||(40513873-40513977)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 40513977 - 40513873
Alignment:
Q  1 atgagttaggtgtttgtctccaaaaactgtatggtaaaattggagagaataaaacaccaaaaatttgcattaacaccgtatttacctcttttttacttaa 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40513977 atgagttaggtgtttgtctcccaaaactgtatggtaaaattggagagaataaaacaccaaaaatttgcattaacaccgtatttacctcttttttacttaa 40513878  T
Q  101 aaaag 105  Q
    |||||    
T  40513877 aaaag 40513873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University